Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12350C4
Clone ID IST12350C4
Vector VICTR76
Project tigm

Sequence tag IST12350C4HMF1
Sequence
NCAGCAACTGAGACCTCGTCTTTCTGGACTTCACAACATTCTACCACTTAGCTCATGATTAGACAGGCCTGCATCAGACT
CATGCACTAATACCTACAGAGGAGGTCTGCCCAGAGCGTCTCANAACTGTTTAATTGGTCAGAAAGGGCTTCCATTGTGA
AGGGCCTTATCTGAGCCCGAGACTGAGAAAAACCGGGAGACATGAGGCACCGCGGGGCTGGGCAGACAGTGAGCCTGTGG
ACATGGTTCTGAGCTCTCCCGTTTAACGGGGACCCAGGGAGGGCAGGTGCCTTCCAGGCTGCTGTCAGGATTTCTCAGTG
GAGTCGGAGTGGGGAGCACTACCTGGGAGAAGACTCCCCCGTGAGGAGTCAGGGAGCACCTTCACCTAGACATTGACTCC
TATTCTCCCTGANCTCCAGGGGCCCAGACTCCTGACTGAAGTCAGGCNTTTCCTAGANGCGCCCTTGANCCTGTTGTCAT
GGTGAGTCCCTCTGATGTCCCTGTTTGTCCCANCCTGGGTGAGCTGTTTTGTTNCNNTGN
Sequence Type genomic DNA
Unitrap ID UNI14303

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 107643764..107644295 520
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033685 (Ucp2) NM_011671 uncoupling protein 2 (mitochondrial, proton carrier) Gene [Source:MGI (curated);Acc:Ucp2-001]


Sequence tag IST12350C4BBF1
Sequence
CTANCAACTGANACCTNNTCTTTCTGGACTTNACANNATTCTACCNNTTANCTCATGATTANACNNGCCTGCNTCANANT
CNTGCNCTANNNCNTACANANGAGGTCTGCCCANANCGTCTNAAAACTGTNNANTTGGTCNNAANNGGCTTCCNTTGNNA
ANGNNCNTATNNNANCCCGAGACTGAGAAAAACCGGGAGACATGAGGCACCGCGGGGCTGGGCAGACAGTGAGCCTGTGG
ACATGGTTCTGAGCTCTCCCGTTTAACGGGGACCCAGGGAGGGCAGGTGCCTTCCAGGCTGCTGTCAGGATTTCTCAGTG
GAGTCGGAGTGGGGAGCACTACCTGGGAGAANACTCCCCCGTGAGGAGTCAGGGAGCACCTTCACCTAGNCATTGACTCC
TATTCTCCCTGANCTCCANGGGCCCANNCTCCTGACTGAAGTCNGGCTTTTCCTANNNGCGCCCTTGANCCTGTTGTCAT
GGTGAGTCCCTCTGANGTCCCTGNTTGTNCNNNCCTGGGTGAGCTGNTTTGTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000033685


For any suggestions or comments, please send an email to unitrap@crg.es