Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST7022-NR
Clone ID PST7022-NR
Vector U3NeoSV1
Project escells

Sequence tag PST7022-NR
Sequence
TTATCTGACTTCTTGTTTATCACTTTTGGGGGGTGGGTGGTAAATGTTAGCTTCTTGCTTTGGATGGCAGGTCCTCCAAT
AGTGCTAATTATTATTGCTTAAACCTTAGACTTTAAGGTAAGAGGAAACTGGCAGGGGGCCCTGGGTCTGTGGAGAGGGG
TTTAAAAATGGTTTTCCCCACTAGTGTCTGGGAGAGGTTGTTACCTCAAGACTTGGAGGACCACATAACAGACACCTTAT
ATCTGGGCTGTTT
Sequence Type genomic DNA
Unitrap ID UNI1163

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 124476085..124476337 253
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025316 (Banp) NM_016812 BTG3 associated nuclear protein Gene [Source:MGI Symbol;Acc:MGI:1889023]

 
Come back to gene ENSMUSG00000025316


For any suggestions or comments, please send an email to unitrap@crg.es