Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11083A6
Clone ID IST11083A6
Vector VICTR76
Project tigm

Sequence tag IST11083A6BBF1
Sequence
CCTGGGTTACAGAGTTACAAATTAGGGGATTACAAATAAAGAGGGACAGGTATAAGGTTGAGTTCACTGACCAACTTTGA
AGCTGGTATACTTGCAGCACAGAAAAGGAGGAGGAATAAGGTAGGTGAGGCCTTTCTGCTTTGGCAGTGGTTGACATTCA
CCGTGAGGAGTCAAGTAATCAATTTTACACAATCAGTAAAATTCCATACTGGTCATCTTCTGGCATTTTTCAGATTAGGG
CAATGACAAATGAGATCACAGGCCCTCCCTGTGACACCATATTGCTTGCATACCTCACCATCTACCCCAGCATTAGGACT
ACCAATCTTCCAGCTGCCATTCCTTATGCAATCCAATCNTTTGGTAACTGACCTTTTCATCTATCATTAATCATCTTGAT
CTGGCTCTTGCTACTACCCTCCTTCCTCTCTCCACAAGGTCCCAGGTCATGTCTACTCTATTCTATCCCANGTATAACTG
GTTCTGGCTATGTTCACTCTTTTGTGTATAATATACTTTCTCCTNCAACATACCTAGAANCAGTGATGTCTTTACATTTT
NATTTCTTCTTTTN

Sequence Type genomic DNA
Unitrap ID UNI14331

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177104190..177104761 561
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078868 (OTTMUSG00000016580) predicted gene, OTTMUSG00000016580 Gene [Source:MGI Symbol;Acc:MGI:3652251]


Sequence tag IST11083A6HMF2
Sequence
TTTCCAGTCAAGGAGAGGTTGCAAGTTGAGACCAAGATACAGAAAAATATTACTTAGTAAACCTGAGAA
Sequence Type genomic DNA
Unitrap ID UNI16949

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 96305828..96305894 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022915 (1700093J21Rik) RIKEN cDNA 1700093J21 gene Gene [Source:MGI Symbol;Acc:MGI:1921546]

 
Come back to gene ENSMUSG00000022915


For any suggestions or comments, please send an email to unitrap@crg.es