Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11260G8
Clone ID IST11260G8
Vector VICTR76
Project tigm

Sequence tag IST11260G8BBF1
Sequence
CAGAGTTCAAATCCCANCAACCACATGGTGGCTCACAACCATCCGTAACAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI12672

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20308862..20308919 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 18030962..18031019 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026743 (Mllt10) NM_010804 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 Gene [Source:MGI (curated);Acc:Mllt10-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 55580660..55580717 56
NO GENE  


Sequence tag IST11260G8HMF1
Sequence
CAGAGTTNAAATCCCAGCAACCACATGGTGGCTCACAACCATCCGTAACAAGATCTGACTCCCTCTTCTGGTGTGTCTGA
AGACAGCTACAGTGTACTTACATATAATAATAAATAAATCTTTAAAAAATGCATAATAAATG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 36905093..36905233 131
NO GENE  

 
Come back to gene ENSMUSG00000026743


For any suggestions or comments, please send an email to unitrap@crg.es