Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10229G4
Clone ID IST10229G4
Vector VICTR76
Project tigm

Sequence tag IST10229G4HMF1
Sequence
TTGCTACTCCTCTGTGGCTTGTGTGTGTCCTGGTAGCTGATTANACCACCCANTCTGTGCATATACAAATTCCTACATTC
TGACCTCCAGGCGATTTATGCTTCTGCCCAGTCTCCTGGGCACCCCAGTAGGTCACATATACTGGGTTCACCTGGGGAGC
CTTAAAACCTCCAGATTTAATTGACCTGCAGTTTCACCAGTCACTGGGAGTTTGCCAAGCTGCCCTGATGGTTTTAAAGT
ACAGCCNGCTATATGGATGGGTGCACACCANACAGGGTTAGGCGGATCCATTTGAATTTGAAATCTTGANGAAAACAGGG
GACTGTCTCAAGGCCCCGGCACTGGCTGGTTGCAAGGCCTGAACCAGGATAAGGCGCCTGCAGTTCTAGCTGGTGTCATC
ACTCACCCCACCTCGTGGCCTGGAACGTTCTCCTTCCGAGCCTNANNNNGNNCGTGCGTGTGTCGTGTGGGGGGTGGANT
CCACGTGCCACAGTGTATCTGTNNAGTNAGANGACNGCTTTNTGGAGCGGGTTCCCTCCTTCN
Sequence Type genomic DNA
Unitrap ID UNI30528

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79457168..79457709 504
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017639 (Rab11fip4) NM_175543 RAB11 family interacting protein 4 (class II) Gene [Source:MGI (curated);Acc:Rab11fip4-001]


Sequence tag IST10229G4BBF1
Sequence
TTGCTACTCCTCTGTGGCTTGTGTGTGTCCTGGTAGCTGATTANACCACCCAGTCTGTGCATATACAAATTCCTACATTC
TGACCTCCAGGCGATTTATGCTTCTGCCCAGTCTCCTGGGCACCCCAGTAGGTCACATATACTGGGTTCACCTGGGGAGC
CTTAAAACCTCCAGATTTAATTGACCTGCAGTTTCACCAGTCACTGGGAGTTTGCCNAGCTGCCCTGATGGTTTTAAAGT
ACAGCCNGCTATATGGATGGGTGCACACCANACAGGGTTAGGCGGATCT
Sequence Type genomic DNA
Unitrap ID UNI30528

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79457168..79457455 280
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017639 (Rab11fip4) NM_175543 RAB11 family interacting protein 4 (class II) Gene [Source:MGI (curated);Acc:Rab11fip4-001]

 
Come back to gene ENSMUSG00000017639


For any suggestions or comments, please send an email to unitrap@crg.es