Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14634C3
Clone ID IST14634C3
Vector VICTR74
Project tigm

Sequence tag IST14634C3HMF1
Sequence
CTGGGATTCTAGTTTCACTGCCACTTCCTGCAGAGGAAAGGGGACGGTGGTATCAAAATCCCTACAGATTCAAACTCACT
TGGGAAACGAGAAGAAATGTTACCAATGCTTGCTTCTCTGGTCGCCACTACAAGGACGTGAAAAGATGGGAAAGCTACCT
TAGTAATTACAAAACACAAGCAGCCTCAAAGGCCTTTTCTGGGGGGAGCAAAGGCGAGCCCCCCCCCCCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 61715955..61716183 229
 
EST/CDNA Est Name
  AA014055.1 - AA030352.1 - CX734444.1


Sequence tag IST14634C3HMR1
Sequence
CCAGAAGGCCNGGCATCCCCAGTTGCTGTACNAGAGCAAACTGTATAAGATTCTTCAAGGTGGGGTTGGCATCCCTCACA
TACGGTAAGCACCTTTGGGCACAGAGGGAGTTGCGAAATGGTGAAAGGGGTTGAGGCTGGTAATTGGACCCGATGAATCG
GTCTTGGTGCTGGGTCCTCCANATTCCACAGTTC
Sequence Type genomic DNA
Unitrap ID UNI11712

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 61716180..61716372 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024576 (Csnk1a1) NM_146087 casein kinase 1, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1934950]

 
Come back to gene ENSMUSG00000024576


For any suggestions or comments, please send an email to unitrap@crg.es