Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15077H10
Clone ID IST15077H10
Vector VICTR80
Project tigm

Sequence tag IST15077H10BBF1
Sequence
TGTATTACAGAGATGCCCTTAGCCTGGCACAACTTTAATACCAGCATTTGGGAGGCAGAGGCAGGACGATCTCTGTGAGA
TAAGAGACCAGCCTGGTCTATAGAGTTCCAGCATAGCCAGGTCTCAAAAAAACAAAAAACCCAAAAAGATGTTCTTGTTG
TATTGAAATATGTAATTGTGTTAAATCTTTTCTCTGAGTGTCCCCTCCCCTGCCCCACACCATCCCTGAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI33565

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109573094..109573327 234
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031916 (Cog8) NM_139229 component of oligomeric golgi complex 8 Gene [Source:MGI (curated);Acc:Cog8-001]

 
Come back to gene ENSMUSG00000031916


For any suggestions or comments, please send an email to unitrap@crg.es