Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AK0408
Clone ID AK0408
Vector pGT0lxr
Project sanger

Sequence tag AK0408
Sequence
CGTTCTCCTCCTTCGGTTTCCTTGCCTCTCGTACGGACTGTTAGCTCCTATGTTTTTTGATTCTCATGTCTCTATTTTTC
CTCACTTTACTGTTAGTGAGATGAAGTCAGCATCTGGCCAAAATAAAGCTTCAGGCAAGAGGCAAAGGTCNCAGTGGGAT
TTGGGAGCATGGTAAACGGGCAGCACCTTCTACAGCAGAGACATTTTCTAAGAAAAGCAGGAAGTCGGACAGTAAGAGCA
CTCGCCCTGCTGAGCACGAGCAGGAAACCGAGTTTGAGCCAGAAGGCCTCCCAGAAGTCGTTAAAAAAGGGTTTGCTGAC
ATCCCAACTGGAAAGACAAGCCCATATATCCTTCGGAGAACAACCATGGCAACCAGGACCAGCCCCCGCTTTGCTACACA
GAAGTTAGTGGGATCTTCCCCATCTCTGGGCAAAGAAAATGTTGTAGAGTCCTCCAAACCAACAGCTGGTGGCAGCAGAT
CACAAAAG
Sequence Type mRNA
Unitrap ID UNI2739

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 191470681..191472708 217
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026605 (Cenpf) NM_001081363 centromere protein F Gene [Source:MGI Symbol;Acc:MGI:1313302]

 
Come back to gene ENSMUSG00000026605


For any suggestions or comments, please send an email to unitrap@crg.es