Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST7640-NL
Clone ID PST7640-NL
Vector U3NeoSV1
Project escells

Sequence tag PST7640-NL
Sequence
CATGCATAAAAGCTGTTGGCATATATAATAGTGCAATTATGCCTTTAAGCTTAGTCTTAGACCTAGGTTTTATAGAATAA
CTAC
Sequence Type genomic DNA
Unitrap ID UNI14741

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 23109958..23110041 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022884 (Eif4a2) NM_013506 eukaryotic translation initiation factor 4B Gene [Source:MGI (curated);Acc:Eif4a2-002]

 
Come back to gene ENSMUSG00000022884


For any suggestions or comments, please send an email to unitrap@crg.es