Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10889E3
Clone ID IST10889E3
Vector VICTR76
Project tigm

Sequence tag IST10889E3HMR1
Sequence
ATACGTGTATAGGGTTTCCCTTGGACAAATGAAAAATTTAAATCAACAAACAAAAGAGTTCTAGTTTTGACAGTACCAAG
ATATATTTTTTTCTAAAGGTTTAATTTGGTGATGGCTTTGGTAGAGTAAATTATAGAGAAGAAAAAGTTTGTGAAACAAG
CTGTCCATCTCAATGGCAAGTTCNAAAAACCATAGACTTAAGCATTGACTCANTACGTGTAGCTACCACGTAGATGTTTT
TGGTGCCAGACTTACTTGATCCACCAAACTTTCTGTTTACAACGCCCATCACTGTGTGTACACCTTCCGAACTGTGCGCC
TGGGTCTTCCACTTCTCAGGTCCCACANCGTAACTCTGCACAGATGTANCCTCTAACTATCATTTGGTACACTCCATCCN
GCTTTGGGCACAGGACANGGANGGGACANNGTTNNNCGCNGTGATCGATTTGGGGGCN
Sequence Type genomic DNA
Unitrap ID UNI17054

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 94003212..94003668 429
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047109 (Cldn14) NM_019500 claudin 14 Gene [Source:MGI (curated);Acc:Cldn14-001]


Sequence tag IST10889E3BBF1
Sequence
TTATGACTATACATGTATTGCTAGAATTATATGAACTCANCTAGGTCATACTATGGAAAGCCAAAATCAGTTGCTTTTCT
GTTGCTGTTATAAAACACCATGACCAAAGGCAACTGACTTACAGAAGGAAAAAAATCTGTTTGGGCTCCTGGCTAAAGGT
GTAAGCCTCTGTCGTGGCGGGAAGAGACAGGCAGGGCAGCAGGAAGCANAGCGGTTACAAAGGAGGGTGAACAGGAATGA
GGCGGTTACNCANCANGGTGAACAGGAGTGAGGAGGACTATAAACACTCAAAGCCCCTCAGTGACTTCCTCCCTTCANCA
AGGCTCTACCTTCCAACAACCACCCNAACCCCATCAACTNNGGATCATGTGTTCAAATACCCGTGACTATGGGGGGCAGT
TGTCATTCNNNCCACCACNNATTATATTTNACGTGCCTATAACAAATATTTAAAAGGTTTNAATTAATTTTTTGTTTTAT
GTGCCTATNACAAATATTTAAAANGNTTNAATTAANTNNNTN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 94003666..94004179 474
NO GENE  

 
Come back to gene ENSMUSG00000047109


For any suggestions or comments, please send an email to unitrap@crg.es