Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15086F6
Clone ID IST15086F6
Vector VICTR80
Project tigm

Sequence tag IST15086F6HMR1
Sequence
TACTCNNGTTCCAAGTCTTTACACTCANGGAGCTCCCGGCAAGGATGCTGACAGCACCCTGCANTGTCTGGAGTGTCTNA
CAAGGAANGGCTCGTGGCACAGGGGAGCTCANGCTGACTANTCTTTNNATATGACCGGCCAGAAACTCAACTCTTTTAAG
TCACATAGTTTTGCTTGGTCAAAAGAGTCCTAAGAGAGTCATGAAAATGACTCCCTTACAGCTTTGGGACAGTANAGTCA
GTGTCTCTCTCCTGCCACCATCATCAGCATGGTAGCTAGGAAGGTTTGCAGGGGCTGCAGCCTGANGGTGTAACTCCTGG
CTTGGCCTCTAGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 79135003..79135335 309
 
EST/CDNA Est Name
  BE456814.1


Sequence tag IST15086F6BBF1
Sequence
CCAGCAACCACATGGTGGCTCACAAACATCTGTAATGGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI34742

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4189602..4189644 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 58433803..58433845 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22983640..22983682 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96544765..96544807 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 121847691..121847733 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 79055563..79055605 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 90716643..90716685 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 43008046..43008088 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 31815878..31815920 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 67928698..67928740 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 19966400..19966442 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060090 (Rp2h) NM_133669 retinitis pigmentosa 2 homolog (human) Gene [Source:MGI (curated);Acc:Rp2h-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 69376995..69377037 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 193662531..193662573 41
NO GENE  

 
Come back to gene ENSMUSG00000060090


For any suggestions or comments, please send an email to unitrap@crg.es