Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10947B3
Clone ID IST10947B3
Vector VICTR76
Project tigm

Sequence tag IST10947B3HMR1
Sequence
ATGGGAGGCAGAGGCAGGCGGATCTCTGAGTTCAAGGCCAGCCTGGTCTACAGAGCAAGTTCCAGGACAGCCAGGGCTAC
ACAGAGAAAGCCTGTCTAGGGAAAAAGGGGGCTTAGACTTGACCATTGTAGGATAGGAAATTCAGCATTGTTTGCTATCC
ATGAAGGGCTGCGCAGACACATCCAGAATGCAGGCTAGGCTGGGCCGAAGGTGTTC
Sequence Type genomic DNA
Unitrap ID UNI15535

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165633898..165634112 215
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]


Sequence tag IST10947B3BBF1
Sequence
CCATGTGCTGGGATTAAAGGCATGCGCCACCATACCTGGCTTTTTAAAGTTTTCTTAAAAGCGTTAAGTTGGGGGCTGGG
GATGTAGCTCAGGGGCACTATTCGACTGCAATGACCTGGGCTTAAGTTTGGAGGGCTGTGGGCGGGACGGGAAGTCAGTG
GANAAGCTGCACAGTATACTGAACTTACTTATAAAGAGGAGATTGGGGGTGTGGGGGGAGCCTGGANAGATGGCTCANTA
CTTAAGANCACACTGACTGTTCTTCCGAAGGTCCCGAGTTCAAATCCCANCAAACACGTGGTGGCTCACAACCATCATCA
TGATCAGATCATGAGATCTGT

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165634109..165634448 330
 
EST/CDNA Est Name
  DV066041.1 - AI427345.1 - CK622678.1 - AW762466.1 - W49202.1 - CA570430.1 - CA570198.1

 
Come back to gene DV066041.1 - AI427345.1 - CK622678.1 - AW762466.1 - W49202.1 - CA570430.1 - CA570198.1


For any suggestions or comments, please send an email to unitrap@crg.es