Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12356H10
Clone ID IST12356H10
Vector VICTR76
Project tigm

Sequence tag IST12356H10HMF2
Sequence
AGGTCATGAGTTCAATTCCCAGCAACCACATGGTGGCTCACAACCATCTGTAATGGGATCTGATGCCCTCTTCTGGTGTG
TCTGAAGACAGCAATGATGTACTCATATACATAAAATAAATANATAAATCTTTAAAAAAAAAAANAN
Sequence Type genomic DNA
Unitrap ID UNI31455

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 115634103..115634246 142
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91978298..91978441 142
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058318 (Phf21a) NM_138755 PHD finger protein 21A Gene [Source:MGI (curated);Acc:Phf21a-002]


Sequence tag IST12356H10BBF1
Sequence
AGGTCATGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCCTAACGAGATCTCANNANCCTGAGGCANANG
GAGCTCACAGCTCTCCTGANCCNTANNAAGACCTTCCTGGGGGGATGCCTGACTGCCANAGTTTGACCCCTGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000058318


For any suggestions or comments, please send an email to unitrap@crg.es