Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14881G4
Clone ID IST14881G4
Vector VICTR76
Project tigm

Sequence tag IST14881G4HMR1
Sequence
NNGGNTCCCTGNNNGNNCNNGGNANNNNNAATACAGAACCACTTCCCAGTATTCAGTTGTAGACAGCACATGGCAGTCAC
CCCACTCCTCTGTGGATTCGGGTTTACATAACTGCATCACCAACACCTTCCCTTCTGACCCCAAATTCTAACAACAGCGA
CGCCACTTTGATAGCTAAGGGGAAAATTCACCAGATACNNAGCANACAAAACACTCTTTTAAGAAAAGGCTAANTAAGGC
AAGATCTTTGCTTTCATANCNCANGTGACANTACACTCCTCNNATGANGTTCANAGTGANGCNNCTNNNGCTCNNNGACN
NCNNANTGGATGCTGTGCTNNANGNTNACNNTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14881G4HMF1
Sequence
CTGGGACACTGTGGGGGAAGTGTCTAGTTTAATGTGGACCACTGACCCTGCATATAGGGCTTCTTATCCATGATCTACAC
ACAGGGAATAGATGGTGGGAAGAGAGATGTCTGGGTTGTCTGAAACCCCACCTATTGGGAATGCAAAGGGCAAATGTCTG
CTCCCAGATCTTAACCNACCAGGATAANACCCATTGCCNGNNNTGNCNANACTCANANCCNGGTTGGGCNTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14881G4BBF1
Sequence
CTGGGACACTGTGGGGGAAGTGTCTAGTTTAATGTGGACCACTGACCCTGCATATAGGGCTTCTTATCCATGATCTACAC
ACAGGGAATAGATGGTGGGAAGAGAGATGTCTGGGTTGTCTGAAACCCCACCTATTGGGAATGCAGAGGGCAAATGTCTG
CTCCCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI486

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6013143..6013313 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038587 (Akap12) NM_031185 A kinase (PRKA) anchor protein (gravin) 12 Gene [Source:MGI Symbol;Acc:MGI:1932576]

 
Come back to gene ENSMUSG00000038587


For any suggestions or comments, please send an email to unitrap@crg.es