Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14812H11
Clone ID IST14812H11
Vector VICTR76
Project tigm

Sequence tag IST14812H11HMR1
Sequence
CAANCAAACACCAAACCCCAGACCATGGCCTCACTCNNTGTCATGAANATTTATTCCTGGATTTCTTTCCCTGCTTCTTT
CTGTCCTTCTGGATAATGCTATGATGTAGGGTTGCTAGATCATAATGTGGTANTCTGCCTTTTGTAGTTTGAGAAATTGC
CTTGGGGGGGGGCATGGGTAACATCTGTACCATTTTATGCTCATGCCAANAGTGTCTGANTGTTGCC
Sequence Type genomic DNA
Unitrap ID UNI1445

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 84312878..84313103 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028487 (Bnc2) NM_172870 basonuclin 2 Gene [Source:MGI (curated);Acc:Bnc2-001]


Sequence tag IST14812H11BBF1
Sequence
ATACCAAAAGTGAGAACAAGGAAAATATTATGTACATTGGACTTCATCAAAATTTAAAAGGTCTCATCCTACCCTGATAG
ATGACAGTGCGAGGAACTTTTCTGAGGGTCACTGTTGCTCTTGAATTGAGTTGTTACCATTTAACATGCANNAAAATCTT
GGTTGGAAAAAAAAATATTCTTAAACTCCTTTCAAAAAAAAAACCNTTTTTAANTNNTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 84313133..84313346 204
 
EST/CDNA Est Name
  BF721729.1

 
Come back to gene BF721729.1


For any suggestions or comments, please send an email to unitrap@crg.es