Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10481H5
Clone ID IST10481H5
Vector VICTR76
Project tigm

Sequence tag IST10481H5HMF1
Sequence
TGTGGAGCTTTANCGAACTGTTTTTCATGAAAGAACCNCAGGATGCAACAGTCACAAGGAAAGACCCAGTCGTTTTANAT
TGCCAGGCACACGGAGAAGGCCCCATTAAGGTCACATGGTTGAAAAATGGAGCAAAATTGTCCGAAAATAAACGGATCCN
NGTTCTATCTAACGGCTCTNTNTNCNTNANTGAGGTGGAAGGCAGGANGGGANANCAATCGGATGAAGGATTTTATCAGT
GTTTGGCAGTGAACAAATACGGGGCCNTTCTTANTCNNAAAGCTCATCTGACATTGTCAAGTAAGTGCTGAAATTCTTCT
TGGTGGTNAACGGTTTTCATTGTTAGAATATATTTTCCGAAATTGACTTACNNATANCACTNAAATNATGCNTACNNTAN
NAATTTTTACCNGANNGGATGCTAGCTGGCGCTTNNGGATGCNTGCNNNNAAATCTATGTNTGTAAACTCCANNNTTTNG
GAAGCNAACTCAAATNCNNACTTTGGNCACNGNGTGAAAGAAAACCTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10481H5BBF1
Sequence
TGTGGAGCTTTAGCGAACTGTTTTTCATGAAAGAACCACAGGATGCAACAGTCACAAGGAAAGACCCAGTCGTTTTAGAT
TGCCAGGCACACGGAGAAGGCCCCATTAAGGTCACATGGTTGAAAAATGGAGCAAAATTGTCCGAAAATAAACGGATCT
Sequence Type genomic DNA
Unitrap ID UNI16842

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72657265..72657422 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036030 (Prtg) NM_175485 protogenin homolog (Gallus gallus) Gene [Source:MGI Symbol;Acc:MGI:2444710]

 
Come back to gene ENSMUSG00000036030


For any suggestions or comments, please send an email to unitrap@crg.es