Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11193D2
Clone ID IST11193D2
Vector VICTR76
Project tigm

Sequence tag IST11193D2HMF1
Sequence
GAGGGTACATATCAGATAATGGGCTTTATGGCCCATCTGACAGTCTGTTCTGTGTATACATCTAGGGCACAGGGTAGTGA
TTGGTACTTACCACTGAAGTATGCAGAAGTTCCATGTANATATCAAGACTGAAAAGAGTATGCTTTATGTGCCCAGGAGA
GGAACGCATTTGTTTTTACCTAANGTTGTCATTCTTNCN
Sequence Type genomic DNA
Unitrap ID UNI35167

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 101907229..101907424 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027861 (Casq2) NP_033944 calsequestrin 2 Gene [Source:MGI Symbol;Acc:MGI:1309469]

 
Come back to gene ENSMUSG00000027861


For any suggestions or comments, please send an email to unitrap@crg.es