Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST9334-NL
Clone ID PST9334-NL
Vector U3NeoSV1
Project escells

Sequence tag PST9334-NL
Sequence
CAAAGTTACCACGGGATGCCACCATGTGCAGAGAGAAGTGGGGCTCCTGAAGCCACTCCCATCCTGTGCCTAGCTGTGTC
ATCAGCTGCCTGGCCAGTGGCCAATTTTAGGAGTGGGCCAGGCCCCTGTGATGGACAATCCATCACCCCAGGGTGGGCAG
CCCATCCCCTTATGTAGGTGTCAGTCCCTAAGATGGGTAGGGTACTCCATCATCTCTAGGTAAGAACAAGGCCTCTTGAT
CAGCCTGCCCCATAGCCAACGAGGCTATGTTTTTAAGGTGCAAAGAGTTTGT
Sequence Type genomic DNA
Unitrap ID UNI15392

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 133470696..133910212 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030703 (Gdpd3) NM_024228 glycerophosphodiester phosphodiesterase domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1915866]

 
Come back to gene ENSMUSG00000030703


For any suggestions or comments, please send an email to unitrap@crg.es