Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10456G2
Clone ID IST10456G2
Vector VICTR76
Project tigm

Sequence tag IST10456G2BBF1
Sequence
AATATACTTCCTGTTTCTGAGCTTCACTTCTAAATGAAGCTCAATAAGGAAGGCCCACCCTGCGAAGAAATACAAAGTGT
TCTTCACTTANAGGGAGAGCTCTGAAGCCATCCAATCTCGCTGGCAGCTGAGAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI15532

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12591163..12668334 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031010 (Usp9x) NM_009481 ubiquitin specific peptidase 9, X chromosome Gene [Source:MGI (curated);Acc:Usp9x-001]

 
Come back to gene ENSMUSG00000031010


For any suggestions or comments, please send an email to unitrap@crg.es