Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14919F2
Clone ID IST14919F2
Vector VICTR76
Project tigm

Sequence tag IST14919F2BBF1
Sequence
ATATAAAATAGAATAATTTCCAAAAAGAAAATACATTCTTGGCATAGCAGGGCTTCAGCTAAGGCAGATAAGCATGTGTC
AGACTCTCCCCCACCCCCGTCCCTGTCCCCGGCCAGTGAGTGCTTTTCAGTGTAGTGGCCCAGCTCTCCTCAGTGATCGC
TTCCTGCTTCTCTTCTCCCAGGCAGGGCCATCATTTCTCTGCTCCATGGCAGTAAACTCCCATTTCATTATTAAACTGGG
AATTTTTCCTTTCTGTTTGCCACACTGACCTCCTGGCGCCTACCCCCCTTTAGCTTTTCCNCATTGTCTTACAGTGTGGT
TACTCCTTTANCANACTGGTACTCTCANTANCGGAGCTATCATTTTCTTTACNTCCCCACACTTTGTTTTCTCTCCNACT
TGCTCTNANGCCATCCTTCCNTGAGTTCCTTNNANNANNNNANTCNTTNNNACTNGNATGGCTGCTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14919F2HMR1
Sequence
AGGTAAGACTTAAATAGTGTGCATGGGAATGCACTAAATAGTATGCACGGANATACAATTTCTCTCTTTTTTGTCTTTTA
AGAAGTTAAAGTTTTAAAATTTTACAATACCTAAACCTTNNAATTAATAACTAGTTC
Sequence Type genomic DNA
Unitrap ID UNI30509

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 52079197..52079332 130
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 87789267..87789402 130
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 24048279..24048414 130
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 124749588..124749723 130
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 91356494..91356629 130
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 136940229..136940364 130
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52919857..52919992 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048332 (Lhfp) NM_175386 lipoma HMGIC fusion partner Gene [Source:MGI Symbol;Acc:MGI:1920048]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7469503..7469638 130
NO GENE  

 
Come back to gene ENSMUSG00000048332


For any suggestions or comments, please send an email to unitrap@crg.es