Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AK0255
Clone ID AK0255
Vector pGT0lxr
Project sanger

Sequence tag AK0255
Sequence
AAACCTAGCTAAGTCTGGGTTTTCGCCACAACAAAGAAGCCAACCAGAGCATGGTCTTGGGCTTCAAGTACTAATGAACA
ACGATATTAACTCGTCCGTGGAAAGCCTTAACTCAGCTTGCAACATGCAGTCTGATACTGATACTGCACCACTTCTTGAG
GATGGCCAGCATGCCAGCAACCAGGGAGCAGCATCTAGCTCCCGGGGACAGCCACAGGCGTCCCCGAGGCAGAAAATGCA
ACGCTCGCAGCCTGTGCACATTCTCAGGCGCCTTCAGGAGGAAGACCAGCAGTTAAGAACTGCATCTCTTCCGGCCATCC
CCAACCCATTTCCGGAGCTCACTGGTGCGGCCCCTGGGAGCCCTCCTTCGGTTGCTCCTAGCTCCTTACCTCCTCCTCCG
AGCCAGCCACCTGCCAAGCATTGTGGCAGATGTGAGAAGTGGATACCAGGGGAAAATACCCGGGGAAATGGGAAACGGAA
GATCTGGAGATGGCAG
Sequence Type mRNA
Unitrap ID UNI2746

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11857755..11887645 224
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020176 (Grb10) NM_010345 growth factor receptor bound protein 10 Gene [Source:MGI (curated);Acc:Grb10-005]

 
Come back to gene ENSMUSG00000020176


For any suggestions or comments, please send an email to unitrap@crg.es