Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST9070-NL
Clone ID PST9070-NL
Vector U3NeoSV1
Project escells

Sequence tag PST9070-NL
Sequence
TTGAGATATGTATGAAAGAAAAGTTTCATAGTCCAAGGTAGTATGTAATCATAGAGTAGTGAATTATGAGGTACA
Sequence Type genomic DNA
Unitrap ID UNI15395

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 91456816..91456890 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035150 (Eif2s3x) NM_012010 eukaryotic translation initiation factor 2, subunit 3, structural gene X-linked Gene [Source:MGI (curated);Acc:Eif2s3x-001]

 
Come back to gene ENSMUSG00000035150


For any suggestions or comments, please send an email to unitrap@crg.es