Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14357H7
Clone ID IST14357H7
Vector VICTR74
Project tigm

Sequence tag IST14357H7BBF1
Sequence
CCTGGAGGTAAGAACCATAGGCCAGTTCCAGGTGAGCCAGGTCACCCTGGGAAAAAAGCCAGTCTGTGGGTGAACACTGA
AAACCTGGAGGGGACACTTACGTTTCATGCGTTCCAAAGAAGAAGATGGGGTATTTGTTGGGTGGGGGCTTCACGGCACC
ATCAGCAATGTCATCAATCTGTAGTGTGAGGCAGGCTGGTCAGAGGGCTTCAGGTGTAGGCCAAGAGGCAGCTTTATCCA
GACCCAGTTACCATCCAGTTACTTANGGGGGTTTGGGGTGGGGGGAGGCACACCATGGGAAGACACAGCACCTTCNNAAC
NCAANTCTANAGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56221369..56221700 320
 
EST/CDNA Est Name
  BB279471.1


Sequence tag IST14357H7HMR1
Sequence
CAGGGCCTTCCTGGGACCCAAGGACCTGTTCCCCTATGATAAGTGCAAGGACAAGTACGGAAAGCCCAACAAGAGGAAAG
GCTTCAATGAGGGGCTCTGGGAGATCCNNAACAACCCCCATGCCAGCTACAGTGCGCCTCCGGTGAGTGCCTGGGAACAA
GTGGGCAGTGGAGCATCTATAGGCTCCCAGGAGCAGGGGCTTCCTCANAAACTTCCAGGATGGTTTCTCANTACTGTANN
TCGGATCTTTCTTTGGGGTGTATTGCTGGGCTTTACAGAATGCN
Sequence Type genomic DNA
Unitrap ID UNI35173

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56221697..56221979 271
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002833 (Hdgfrp2) NM_008233 hepatoma-derived growth factor, related protein 2 Gene [Source:MGI Symbol;Acc:MGI:1194492]

 
Come back to gene ENSMUSG00000002833


For any suggestions or comments, please send an email to unitrap@crg.es