Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14735G1
Clone ID IST14735G1
Vector VICTR76
Project tigm

Sequence tag IST14735G1HMR1
Sequence
TGNNNTGCTCTTAACCTCTGANCCNCTCTCTAGCCCCCTTAATTTACCTTTTAAAGAGGGTCTTGTATGTCCTGGAGCTG
GAGTTTCAGGTGGTTGTGAGCTGGGAAATCAAATCCAGATGGTGTGCAAGAGCAGCTGGGGTTCTTGACCTCGGACCTGT
CACTCCAGCTTGACACTGTTCCAGCTTTAGGTGAAACAGGCACACTGGGGACACTCCCCCAGGACTTGCAGATGGAANAA
TCNNCNCTTGGCCCACCC
Sequence Type genomic DNA
Unitrap ID UNI35175

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56905909..56906162 238
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007603 (Dus3l) NM_144858 dihydrouridine synthase 3-like (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2147092]


Sequence tag IST14735G1BBF1
Sequence
ACTGTTCTTCCAGAGGTCCTGAGTTCAATTCCCAGCAACCACATGGTGGCTCACAACCATCTGTAACGGGTGCGATGCTC
TCTTCTGGTGTGTCTGAGGACAGCTACAGTGGACTCATATACATAAAATAAATAAATCTTTAAAAAAAAAAAAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56905753..56905905 153
NO GENE  


Sequence tag IST14735G1HMF1
Sequence
ACTGTTCTTCCAGAGGTCCTGAGTTCAATTCCCAGCAACCACATGGTGGCTCACAACCATCTGTAACGGGTGCGATGCTC
TCTTCTGGTGTGTCTGAGGACAGCTACAGTGGACTCATATACATAAAATAAATAAATCTTTAAAAAAAAAAANNGGGNGG
NNGGNNANANGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56905746..56905905 154
NO GENE  

 
Come back to gene ENSMUSG00000007603


For any suggestions or comments, please send an email to unitrap@crg.es