Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14401D5
Clone ID IST14401D5
Vector VICTR74
Project tigm

Sequence tag IST14401D5HMR1
Sequence
CCTCCATGACCCAACCCAGTAAGATGAGAGCCTGGGCAGCTAGGGACAGCAACAGGACCCCAGGGATTTAGTGTTGCGTC
TGCCAGTTCAGTTCGGTCTGGAGGCTTATTCTTAGTGGGGAGGAAAGGTGTTTTGCTTCTCTGANGAACNNGCTGTGGTC
CNNTTTN
Sequence Type genomic DNA
Unitrap ID UNI25978

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 120441863..120442028 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025132 (Arhgdia) NM_133796 Rho GDP dissociation inhibitor (GDI) alpha Gene [Source:MGI (curated);Acc:Arhgdia-001]


Sequence tag IST14401D5BBF1
Sequence
GAGGTAAGTTCTCCGACAGGGAGATGCTCTGTATGTTAGCCACGTGCAGGACAAGGGTCTGTTTGTTCGTCCCTTCCAAT
GGAATACTGTCCTAAGCTCAACTATGTGATGACCGCTTAAATCCCAAGAGCCCAAAGGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 120442025..120442167 143
 
EST/CDNA Est Name
  BQ942373.1 - BY193573.1 - BB842058.1 - T12286.1 - BG061092.2 - BU526126.1

 
Come back to gene BQ942373.1 - BY193573.1 - BB842058.1 - T12286.1 - BG061092.2 - BU526126.1


For any suggestions or comments, please send an email to unitrap@crg.es