Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12639G9
Clone ID IST12639G9
Vector VICTR76
Project tigm

Sequence tag IST12639G9HMF1
Sequence
CTTTCCCATTCCTGTTGTGTCCTCAAAACCCGGGA
Sequence Type genomic DNA
Unitrap ID UNI18480

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 70178398..70178431 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022074 (Tnfrsf10b) NM_020275 tumor necrosis factor receptor superfamily, member 10b Gene [Source:MGI Symbol;Acc:MGI:1341090]


Sequence tag IST12639G9BBF1
Sequence
CTTTCCCATTCCTGTTGTGTCCTCAAAACCCGGGGCGGCACAGGCGAGGAAAAGATCCCATGGCAAGGGCTGAGTTCCTC
AGTTTGATTTTTGTTTACTATATTGGGGTTTCATACATGCTACACAGACGCTCTACTACTGAGCTACATCCTCAGTAACT
TTTCAAAAAGGTTTATTTATTTTATGTATAAGAGTACACCATTGCTCTCTCAGACACACCAGAAGAGGGA
Sequence Type genomic DNA
Unitrap ID UNI18480

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 70178398..70178626 229
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022074 (Tnfrsf10b) NM_020275 tumor necrosis factor receptor superfamily, member 10b Gene [Source:MGI Symbol;Acc:MGI:1341090]

 
Come back to gene ENSMUSG00000022074


For any suggestions or comments, please send an email to unitrap@crg.es