Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14516C9
Clone ID IST14516C9
Vector VICTR74
Project tigm

Sequence tag IST14516C9BBF1
Sequence
AAGGCAGGCAGATTTCTGATTTTGAGACCAGCCTGGTCTACAAAGTGAATTCCAGGACAGCCAGGGCTATACAGAGAAAC
CCTGTCTCTAAATAAATAAATAAATAAATCTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI34250

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 115888390..115888510 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000016559 (H3f3b) NM_008211 H3 histone, family 3B Gene [Source:MGI (curated);Acc:H3f3b-001]

 
Come back to gene ENSMUSG00000016559


For any suggestions or comments, please send an email to unitrap@crg.es