Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST8535-NL
Clone ID PST8535-NL
Vector U3NeoSV1
Project escells

Sequence tag PST8535-NL
Sequence
AGTTGGACAGCAGTATTGCTGTTCAGTAGACCTGGGGCTGGCTCTAGGGGAGTGAGGAGTCACATGACAGGAGACTGGAA
GGGAAAGGTAAGCCTCTTAGTCAGACTGCCGGGGCCGAGTGACCTGATTCAACATCTTATTGGGCCATTTTCACAGCAGT
GTAAAACCATAAACAAATGCACGGTACACATTTACAAAACAATCTGACGTAAATAATCGAAAGTAAAATGCTGTGTTAAA
CAAATGGAAACATGGAAGTAACTTATAGAACAAAGGATTGAAGCACTGAACATAGATTT
Sequence Type genomic DNA
Unitrap ID UNI15400

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 76346022..76346315 273
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048490 (Nrip1) NM_173440 nuclear receptor interacting protein 1 Gene [Source:MGI (curated);Acc:Nrip1-001]

 
Come back to gene ENSMUSG00000048490


For any suggestions or comments, please send an email to unitrap@crg.es