Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14216F3
Clone ID IST14216F3
Vector VICTR74
Project tigm

Sequence tag IST14216F3HMF2
Sequence
AGCTATAACAGGGTCTTCTTCAGCAAAATCTTTCTGGCATATGCAACAGTGTCCAGATCCCATTCTTACTGAAGAACTAT
TGGTAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 97003783..97003870 88
NO GENE  


Sequence tag IST14216F3HMR1
Sequence
AGCTGTCTCGTATGAGGCTTTGCCAGTGCCTGGCAAACACAGAAGTGGATGTTCACAGTCATCTACTGGATGGAACACAG
GGCCCCCAATGGAGGAGCTAGAGAAAGCACCCAAGGAGTTGAAGGGGTCTGAGCCCTATAGGTGGAACAACAATATGAAC
TAACCAGTACCCCCAGAGCTCGAGTCTCTAGCTGCATATGTAGCAGAAGATGGCCTAGTTGGCN
Sequence Type genomic DNA
Unitrap ID UNI10738

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 97003564..97003786 223
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032449 (Slc25a36) NM_138756 solute carrier family 25, member 36 Gene [Source:MGI (curated);Acc:Slc25a36-001]

 
Come back to gene ENSMUSG00000032449


For any suggestions or comments, please send an email to unitrap@crg.es