Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13571C4
Clone ID IST13571C4
Vector VICTR74
Project tigm

Sequence tag IST13571C4HMF1
Sequence
CCTTCTCTTGTTCTGAGTCTCTCTCCNNCAGGGGATTTTTGANACTCANGGNTGACTGGGGAANGGATNATGGATGCNAN
TCANNCTGCCTTAANGAANANCCCCTGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13571C4HMR1
Sequence
AAGGGATAGAACACGCCCCCTCCCAGCAAAAGCAAACAAAACACAAGTTTCTTGGAATGTAGCTCTCTCTGAAAGGCCTC
CAGGGGCCCTTGGCCGGTCAGAGCTCCGTGCACAACTACTCATACAATCCTTTAGAATAGGATTCTGCTTCTCTGGGTTT
GACCGCGTCACAAATATTTATACAAGTACTAGATGTGGTAAAGTTTATTATTCTATTGCACTGAATGTGATCAGATACCA
TTAACCCCAAGTGGCTGGGGTTGCTGGTAAAGACAGAGTGCAGCTTTGATGATTGCTGGGGGTACTTCCTCACGGTATGA
GTCCCAGGTACACCAGGTTGGCGGGCCATATAGAGGACAGATCGGTGCCCAAACCTCTTTAGTTAAGTCAATCAGCCCAG
CACCTCTCCTGGTGTCTAGGCCACCCCCATCCCAGGATGCTGCCTCATCCNTGGCCANCT
Sequence Type genomic DNA
Unitrap ID UNI17456

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 26714965..26715421 455
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072681 (Plac9) NM_207229 placenta specific 9 Gene [Source:MGI Symbol;Acc:MGI:2663998]

 
Come back to gene ENSMUSG00000072681


For any suggestions or comments, please send an email to unitrap@crg.es