Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11490F4
Clone ID IST11490F4
Vector VICTR76
Project tigm

Sequence tag IST11490F4BBF1
Sequence
GTACCGATTGCTGGAAATCAAAGGCAAAACCACAAATGCAATACCAAATACAAATCTGAAGCAACAGAAGCCAGCACAGT
GTAAAGCCCAGGATGGTGCTATCTGTCCAGCAAGGCGTGTAGTCTGAGTTTTTAGGGTCANAGCCTGGGCCCTGTCANCA
CTAACAAGCTAGGCTTGCTCACCTACCCTCTATGTGCCAATTAANANACNATAATGAGTAATAATGATAAACAACAACNA
AAAGTTTCCTNNNNNTGNCCNNNTTGANAANAGAAACANAGAGGTCCNNTGTTGTTCCACCCACATTTTCTGGGTCCTGA
CATGGAAATCANNTTTAAATAAATAGCAAGGGATATGCATAAGTAAGCANTCCTGGTCAATGTGTGGTCTANCCCATCAC
GGCCCCAGCTCCACCGGCTCCTACAAAAGTGGNCTGACAAGTCCTCGGAACTGNNTGAAACCTGTTTCTGGGANACAAGT
TACCCTNTGGCTGNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11490F4HMF1
Sequence
NTACCGATTGCTGGAAATCAAAGGCAAAACCACAAATGCAATACCAAATACAAATCTGAAGCAACAGAAGCCAGCACAGT
GTAAAGCCCAGGATGGTGCTATCTGTCCAGCAAGGCGTGTAGTCTGAGTTTTTAGGGTCANAGCCTGGGCCCTGTCAGCA
CTAACAAGCTAGGCTTGCTCACCTACCCTCTATGTGCCAATTAANANACAATAATGANTAATAATGATAAACAACANCAA
AAAGTTTCCTNANCGTGGA
Sequence Type genomic DNA
Unitrap ID UNI21463

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11729583..11729839 243
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020182 (Ddc) NM_016672 dopa decarboxylase Gene [Source:MGI (curated);Acc:Ddc-001]

 
Come back to gene ENSMUSG00000020182


For any suggestions or comments, please send an email to unitrap@crg.es