Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14178H11
Clone ID IST14178H11
Vector VICTR74
Project tigm

Sequence tag IST14178H11HMR1
Sequence
AGGCACATCTTTNNNTTTTTAACCCCTTNAGTATTANTTAATGGGTGAACACGATTTACAGGATGTCCGTTATCAGATTT
GGTAATTGTGTATTAACGTAGCCTGCTATGTTTATAAAAACGTGTAGTGTTTCTCTCAATAAGTAAAACGAAATTAGCTT
TAAAATCCTACTTTGACATGCCTAAGAAATGGATCAAGCAAAAGGCTTTCAGTCTAAGTGAATTTGTATGAGGTCTCCTG
TACTCTAGACTGGCCTTGCNCCACTCTCCTTTTTCCGCCTGGANTACNATCGAGTGAGGGC
Sequence Type genomic DNA
Unitrap ID UNI10501

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 51197396..51197696 281
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021395 (Spin1) NM_146043 spindlin 1 Gene [Source:MGI Symbol;Acc:MGI:109242]

 
Come back to gene ENSMUSG00000021395


For any suggestions or comments, please send an email to unitrap@crg.es