Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13097D3
Clone ID IST13097D3
Vector VICTR76
Project tigm

Sequence tag IST13097D3BBF1
Sequence
GTCCTCTACCATCATCATGAGATATGCTTTTAAATCTAGGTCTAGGTTCTCAGGTGTGTTGGGGTTCCCTGGACTGGGCG
AAGTGGGTGTGCTGGGTTCTGGTGATGGTGAGTGGTCTTGGTTCCTGTTAGTAAGATTCCTCCGTTTACCTTTCGCCATC
TGGTAATCTCTGGAGTTAGTAGTTATAGTTGAATCTGTTTAGAGATTGTTCTTCTGGTGATTCTGTTACCGTCTATCAGC
AGACCTGGGAGACAGATTCTCTCCTCTGAGTTTCAGTGCTCAGAGCACTCTCTGCTGGCAAGCTCTCTTACAGGGAAGGT
GCNCAGATATCTTGTATTTGGACCTCCTCCTGGCCNAANAAGANNNNCCAAAACAGGACCTTTCTCAGACACTGTGTTGC
TTTGGCAGTTCCCNNGTGGTACNNACTCTCACCTAANCNNACTAAATTN
Sequence Type genomic DNA
Unitrap ID UNI3370

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 150267126..150267573 420
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068130 (Zfp442) zinc finger protein 442 Gene [Source:MGI (curated);Acc:Zfp442-001]


Sequence tag IST13097D3HMF1
Sequence
GTCCTCTACCATCATCATGAGATATGCTTTTAAATCTAGGTCTAGGTTCTCAGGTGTGTTGGGGTTCCCTGGACTGGGCG
AAGTGGGTGTGCTGGGTTCTGGTGATGGTGAGTGGTCTTGGTTCCTGTTAGTAAGATTCCTCCGTTTACCTTTCGCCATC
TGGTAATCTCTGGAGTTAGTAGTTATAGTTGAATCTGTTTAGAGATTGTTCTTCTGGTGATTCTGTTACCGTCTATCANC
ANACCTGGGAGACAGATTCTCTCCTCTGAGTTTCAGTGCTCAGAGCACTCTCTGCTGGCAAGCTCTCTTACAGGGAAGGT
GCGCANATATCTTGNANTTGGACCNNNNNNNGGCCNANNAAGAAGGCCCAAAACAGGACCTTTCTCANACACTGTGTTGC
TTTGGCAGTTCCCAGGTGGTACANACTCTCACCTANNCN
Sequence Type genomic DNA
Unitrap ID UNI3370

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 150267139..150267573 401
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068130 (Zfp442) zinc finger protein 442 Gene [Source:MGI (curated);Acc:Zfp442-001]

 
Come back to gene ENSMUSG00000068130


For any suggestions or comments, please send an email to unitrap@crg.es