Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST8061-NL
Clone ID PST8061-NL
Vector U3NeoSV1
Project escells

Sequence tag PST8061-NL
Sequence
ACAACCTTTGCTTCCACTAGTAGTCCACAGGACTAGAGATGCCTTCCTCCTTAGTGTTGGTCAATACCTTCTTACCCCAC
GAGAGGGCAGAGAAAGCTAGTAGTAGAGACAGCAACCCACAGTGTAAAGTGCTATTAGTAAGATGGGTCTCTCATGAGTT
ACAGCTATGTAATTTTTATATAGTTAAAAGTGAAGTGAATTCTTCAATTGGAACAGTAGCTCAATAGGACGTTTGTCCAG
TATGCCCAAGCCACAGGTTTTTGAAAACCCAGTATTGGGGTAGGGAATGGAA
Sequence Type genomic DNA
Unitrap ID UNI15315

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180413176..180413467 292
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]

 
Come back to gene ENSMUSG00000038914


For any suggestions or comments, please send an email to unitrap@crg.es