Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10831E5
Clone ID IST10831E5
Vector VICTR76
Project tigm

Sequence tag IST10831E5HMF1
Sequence
ATATAACAGCACAGTTGAAACAAAGCACAGACCTTCAGCTAACATTCTTAAAAAGTAATGTATTTCTAATTATGCNTGTG
TNNNNCACACACNCNCACACACACACACACACACACACACACACNCN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10831E5BBF1
Sequence
ATATAACAGCACAGTTGAAACAAAGCACAGACCTTCAGCTAACATTCTTAAAAAGTAATGTATTTCTAATTATGCATGTG
TATN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89527255..89527337 83
NO GENE  


Sequence tag IST10831E5HMR1
Sequence
ATTGTGCTCTATTGTGAAACTGCTCTTCAATACAGATGCTCCTGGCTTATGCTGATCTGGCTTGTGTGCCTTTTCAACTT
CATTATGTATACAAAGAGCATACACGTCAATAGGAACGTATTTCACAGTCTGATCTTTCCCAGACATGTGCAGTTCCAC
Sequence Type genomic DNA
Unitrap ID UNI10917

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89527336..89527493 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027951 (Adar) NM_001038587 adenosine deaminase, RNA-specific Gene [Source:MGI (curated);Acc:Adar-005]

 
Come back to gene ENSMUSG00000027951


For any suggestions or comments, please send an email to unitrap@crg.es