Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10946B3
Clone ID IST10946B3
Vector VICTR76
Project tigm

Sequence tag IST10946B3HMR1
Sequence
ATATATGATAGACGGGAAGACTGTATATCACCTGCCTCAAAGCCNCAGATCTGATGGCCCAGCGTTCCAGGCTCTTGCCT
TAGCGGGGATGTCTATGGCTCCCTGTGGAGCCATGGCATTTTAATGAAAGTTTTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22412594..22412728 133
NO GENE  


Sequence tag IST10946B3BBF1
Sequence
ATATGTTAATGTGAACTTTTAGGCGGCAAGGAAATAATCTTAAAATCAGAATAAACAAAAAAGGCCCCCATGCTTGTGCC
CTTTACTTAAGAATATCCAGGCCTNAGGAATGAGGCTTGAATTTTAATCATTCTTTGCACTTAAAGGTAAACGCAGATCT
G

Sequence Type genomic DNA
Unitrap ID UNI12510

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22412438..22412597 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]

 
Come back to gene ENSMUSG00000013089


For any suggestions or comments, please send an email to unitrap@crg.es