Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14767B4
Clone ID IST14767B4
Vector VICTR76
Project tigm

Sequence tag IST14767B4BBF1
Sequence
GAGGGGTGAGGGGGGATTTAGCACATATTGGTTTGGTAATGGACACATGCATGTAGGATGGAGTCTTGAGGAGAGTCCTA
CCAGGCAAAGGGAGAGGGTAGATCAAAGGAAGGAATGTCTTGTGATTTTCCTGTGGGTAAGGATCT
Sequence Type genomic DNA
Unitrap ID UNI33122

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 44205983..44206127 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039753 (Fbxl5) NM_178729 F-box and leucine-rich repeat protein 5 Gene [Source:MGI (curated);Acc:Fbxl5-002]


Sequence tag IST14767B4HMR1
Sequence
CCTCGNGCTCTTTNNNGGTGCGGAGGCACTACAGGTTCCTGCNTAAGCCTCCCTTTTCAAGGTTCCTACACCCCTGTATT
GATTGTTCCCCAGGTTTATCTTTACAAACCTGAAGAACTCGCCTTACAGCTGGGAGGAGCTCANAAGAAGAGAGAGATCT
TCATCCCTCGGCTGGTCAGATTGGGGCTCTCTGTCTCACTAGGCATAGCAGGAACCACTGGANCANCCCTCGTCCAAACA
CACCTTCTGTTCAGTGACTTCCAAGACAAACTTGGCCNGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 44206124..44206400 261
NO GENE  

 
Come back to gene ENSMUSG00000039753


For any suggestions or comments, please send an email to unitrap@crg.es