Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST7842-NR
Clone ID PST7842-NR
Vector U3NeoSV1
Project escells

Sequence tag PST7842-NR
Sequence
TCTTGCTCTGCTCATAGTAAACGTAAAGACCCTGGGCCTCAGGCAGAGGAACGGTGCTGAGGTTGGAAAAGGGCAGTCAG
CCTGGGGACCAGGGAACCCCAATGAAAGCACCTTAAGTACTCTGAGAACTTGGTTCCCAGCTCCAGCTTAGCCTTCTGCC
TTTCCCTCCCTGACTGCCTGAAGCTAAGTGTTTCTAGTCTTTTGGTCCTGGAGGCTCATGAAAAACTGGCCACGTATCAG
GGTCTCACTTAAGCCCAAAAGCCAGGGTATCTCTGTTCGT
Sequence Type genomic DNA
Unitrap ID UNI679

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138073180..138073458 273
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029720 (Lrch4) NM_146164 leucine-rich repeats and calponin homology (CH) domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1917193]

 
Come back to gene ENSMUSG00000029720


For any suggestions or comments, please send an email to unitrap@crg.es