Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14247B9
Clone ID IST14247B9
Vector VICTR74
Project tigm

Sequence tag IST14247B9HMR1
Sequence
TTTGTCTATATTTTCNATGCAGTCATGCTCCAGGGCTTGAGAATTGTTTTACATTCCCACACATGTTTGTGTAACACAAA
ACATCTTCAAAGATTTTTACCAGCCATTTTTCTTTCTCCTCTGGCCCACAGACCTGCTCCCAGAAGGAATTTTATTCAGC
TTTGGAAGTTAGTGTGTCCTCTCCTCCNNCACTTGGCAGTGTCTGGGGCCCCAGGGAGACAGGCATTCATCAATCTTTGG
CCN
Sequence Type genomic DNA
Unitrap ID UNI8144

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 146702272..146702513 236
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001630 (Stk38l) NM_172734 serine/threonine kinase 38 like Gene [Source:MGI (curated);Acc:Stk38l-001]


Sequence tag IST14247B9BBF1
Sequence
AAACACGGTCCTGANATACACATTGTAAATCTGGATCTATATATAGAATAAGCAGACAAGGTCTCTTTCCTCCCCCAGAA
GANGATGTAATAAACTTTACTCCAAAACCAAAAACAGATGTTGATGAAAATCTATTCTTAGGTACTTTATAACTGTCATT
AGCATATTCGTTACATTCTTGTTAGACACACCTGAAAGTTCATATGGCTTGATTGAAAACCAGGTCAAAGCAAATGCTAT
CCATCATCACCTCTGTAACCNATGCATGCAGCACTAGATAGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 146701989..146702274 280
NO GENE  


Sequence tag IST14247B9HMF1
Sequence
AAACACGGTCCTGAGATACACATTGTAAATCTGGATCTATATATAGAATAAGCAGACAAGGTCTCTTTCCTCCCCCAGAA
GATGATGTAATAAACTTTACTCCAAAACCAAAAACAGATGTTGATGAAAATCTATTCTTAGGTACTTTATAACTGTCATT
AGCATATTCGTTACATTCTTGTTAGACACACCTGAAAGTTCATATGGCTTGATTGAAAACCAGGTCAAAGCAAATGCTAT
CCATCATCACCTCTGTAACCAATGCATGCAGCACTAGATAGGGATCCTGCATGCCATGCAAACAATCTACTCGGATATAA
TGAAGTTCAGTCTGTGCCTATGCCCCATATATAATCATTTCATANGTTCAAAGCTACAAAACACCTGGTGCAATGTTTGC
CTTCNAAANGAAAACTTCCTCCTAAGANGCATGCNCNGTNNAGCTGGGTCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 146701824..146702274 435
NO GENE  

 
Come back to gene ENSMUSG00000001630


For any suggestions or comments, please send an email to unitrap@crg.es