Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14710B5
Clone ID IST14710B5
Vector VICTR76
Project tigm

Sequence tag IST14710B5BBF1
Sequence
ATCCATCCCCGGTTTTCACACCTGTTAAAAGCAAATAGGTCAAAGAAAAACCCAACTCAAAGTGAACTATGATTTACATT
AAGAAACGCAGCCTCATTAGAAAAGATTTTTAAAGCAAACACCAAGTCGGCATAAAAAAAAGATGAGACTGTAGGGGCTC
AGTAAATACGAAAAGACCTGTCTTAAAAAATATATACAAAGTCCTCAAGACACTATACCAAGAAAACCAGGAGCAAGGAA
GAAAAAGGCGCCATCAAACTAAAGGCCGCGACGTGGAGAATTCATTTAGAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29170034..29170328 295
 
EST/CDNA Est Name
  AW543604.2 - CK336251.1


Sequence tag IST14710B5HMR1
Sequence
GATGAGTTTNNTTTGNCTTTTTGTTTGTTTTTTTAATTTTCNCGGAATGGCTTGGTCGCTCAACTGANTCTTGGGCACAG
GGTGGGGTCACGGCAAAATAGGGTTAAATTTTTTAGTTTGATAATAGTCGGTTTGAACATTATGGTGTATAGTANGGAAN
ACACTTAAATGGCTTATTAAGTAGGGTTTTCATTTCNGAAGTC
Sequence Type genomic DNA
Unitrap ID UNI3589

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29170326..29170527 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071172 (Sfrs3) NM_013663 splicing factor, arginine/serine-rich 3 (SRp20) Gene [Source:MGI (curated);Acc:Sfrs3-001]

 
Come back to gene ENSMUSG00000071172


For any suggestions or comments, please send an email to unitrap@crg.es