Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10594D3
Clone ID IST10594D3
Vector VICTR76
Project tigm

Sequence tag IST10594D3HMF1
Sequence
CTATAAGGTGTTTTCTGTGCTTGCAAACTGGTGCCTAATTAGGGGA
Sequence Type genomic DNA
Unitrap ID UNI30317

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22161084..22161128 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033581 (Igf2bp2) NP_898850 insulin-like growth factor 2 mRNA binding protein 2 Gene [Source:MGI (curated);Acc:Igf2bp2-001]


Sequence tag IST10594D3BBF1
Sequence
CTATAAGGTGTTTTCTGTGCTTGCAAACTGGNGCCTAATTANGGGTCGAGATGGAGAACACTAGGTGGATTCAGTTGGCT
GTGACCGATTAAGTTTATCATAAATTGCCTTTCACTCCCCACGGCCATCTCTAACCCCAACACANTANCNNACTTCCTGT
GAGATGTTAAGAGTAAATATTTACTGTTGTCNNCTGAATTGCTTAACTAAACCATGCGATTAATTTTTTTTGCNTANTTN
ANTGATGAATNATNNNTTTNTTCAGTAAATACGGAGGGTTTTTTGGACAGTATTAGAANTANCATGTTTGTNNNNNNNNN
AGGGANAAGCCAGACTTTAGTAACTGAAGCGCTGGGCTTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000033581


For any suggestions or comments, please send an email to unitrap@crg.es