Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST7587-NL
Clone ID PST7587-NL
Vector U3NeoSV1
Project escells

Sequence tag PST7587-NL
Sequence
CATGTCTCTAAACCCCGGCCTATGGTCTCACCAGTTCACTTTCTCGTTTAGTCGAAATCACTCTGAAGGGGTCGCACAGT
CATTGTGAAGGGCCCCAGGGGGACTCTGCGGAGGGACTTCGAGAA
Sequence Type genomic DNA
Unitrap ID UNI15414

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65782026..65782143 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047215 (Rpl9) NM_011292 ribosomal protein L9 Gene [Source:MGI (curated);Acc:Rpl9-001]

 
Come back to gene ENSMUSG00000047215


For any suggestions or comments, please send an email to unitrap@crg.es