Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10464E10
Clone ID IST10464E10
Vector VICTR76
Project tigm

Sequence tag IST10464E10HMR1
Sequence
TTTTTTCTTAAACTTTGTAGCTTGGGTCTGAGTTTAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI13754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77700364..77700408 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017453 (Pipox) NM_008952 pipecolic acid oxidase Gene [Source:MGI (curated);Acc:Pipox-001]


Sequence tag IST10464E10BBF1
Sequence
GTCNGACTCCTGCAGAGATTTCTGGGGTGACAGGAGGGGACTGAAGCTTAGGAGGTGCGGTGGGAATGAGTGTCTTATGG
GTGGCGTTGGCAGAAGACTTAGACCTGACTTCATTTTGGGAAGTTGGAAGTAATGAACAGCAGACCACGAATCCCTGCAT
ATGGCTTGCCTTACCACGAATCCCTGCATATGGCTTGCCTTACCAGGCTCTGCTTCATTGGCGTAATCGGGTATATTTTA
GGAAAGGAAATTTTCTCAAAATTTCAAAACTGGTTTGTATGGTCTCTTTTTTTTTCTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI2830

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66535765..66536069 301
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019873 (Reep3) NM_178606 receptor accessory protein 3 Gene [Source:MGI Symbol;Acc:MGI:88930]


Sequence tag IST10464E10HMF1
Sequence
CATAGAGAGGGGGAAAAGACTAAGACGTGAATAGTNAGGCTAGTCTANAGAGGAGGAACTGAAATCCTAGGGTTACCAGG
GAACCCTAGCAAGTTTGCAACTCCTACCTCCCAGAATGTCCATCACCTTAACAGGGAGCCCTGGGTATGGAGTCCGCCTT
CCTCACAGCCCACTTTGCTCCANAAGTGAGCAGANGTCGCTGAANAACCCTCTGGACTGTTGATGCCTCTGTGGCCCATG
TACCANANGGTCTGATCACNAANCANTTACTANAAGANGCCTGGGGTCAAGGGGGAGAGGAGAGCAGNNAGGTCCTGGGA
GGGGTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000019873


For any suggestions or comments, please send an email to unitrap@crg.es