Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12705F11
Clone ID IST12705F11
Vector VICTR76
Project tigm

Sequence tag IST12705F11HMF1
Sequence
GTATGGATTCCTAGGAAAACCTCAAAAGAAAGAGGACCCTCTTTACTGTAGTTTGTTTTTTTTAAAATTACTGTTATTTA
TTTATTATTTAATATGAAAACAATCTCCAAACTGAANTGGCTNNGANGTNANTA
Sequence Type genomic DNA
Unitrap ID UNI30161

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 37287892..37288020 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050714 (Zbtb26) NM_199025 zinc finger and BTB domain containing 26 Gene [Source:MGI (curated);Acc:Zbtb26-001]


Sequence tag IST12705F11BBF1
Sequence
TNATGAGAGGCTGGTGAGGTGCACTGGGCAGAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 74856674..74856708 35
NO GENE  

 
Come back to gene ENSMUSG00000050714


For any suggestions or comments, please send an email to unitrap@crg.es