Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12275F2
Clone ID IST12275F2
Vector VICTR76
Project tigm

Sequence tag IST12275F2BBF1
Sequence
ATACTGCACATCACACACCCAGATGGATGGCATGTGAGCTGTGACTGTCTCTGTGTACACACCCATGTGTAGGCACATCC
ATACACAAATCAGACTTACAATCAGCAGACCACCTGGAACTTCCTCCTGTCACCCTGCGCTCAGAGGGCTCAAGATCAAG
GTCTTTTTTTTTTTTTTAAN
Sequence Type genomic DNA
Unitrap ID UNI32092

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57004805..57004981 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024207 (Acsbg2) NM_001039114 acyl-CoA synthetase bubblegum family member 2 Gene [Source:MGI (curated);Acc:Acsbg2-001]


Sequence tag IST12275F2HMF1
Sequence
ATACTGCACATCACACACCCAGATGGATGGCATGTGAGCTGTGACTGTCTCTGTGTACACACCCATGTGTAGGCACATCC
ATACACAAATCAGACTTACAATCAGCAGACCACCTGGAACTTCCTCCTGTCACCCTGCGCTCAGAGGGCTCAAGATCAAG
GTCTTTTTTTTTTTTTNNAAAN
Sequence Type genomic DNA
Unitrap ID UNI32092

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57004801..57004981 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024207 (Acsbg2) NM_001039114 acyl-CoA synthetase bubblegum family member 2 Gene [Source:MGI (curated);Acc:Acsbg2-001]

 
Come back to gene ENSMUSG00000024207


For any suggestions or comments, please send an email to unitrap@crg.es