Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14910H2
Clone ID IST14910H2
Vector VICTR76
Project tigm

Sequence tag IST14910H2HMF1
Sequence
GCCNGAAATTGGGTCATGTAGAATAAACTGCCAAGTGGATGTGCCCTTGGGGCCTCTGGAACTGGAGTTATGGCGAGTTG
TAAACTGGCTGATGATAATGCTGGGAACAGAGTTGGGTCCTACACAAGAGCAGCATGAGTTCCTGAGCCATCTCTCCAGA
CCCTGCTGAAAAACTGAAAATATTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3171804..3171989 184
NO GENE  


Sequence tag IST14910H2HMR1
Sequence
CCTACTTCCTAAAAGGAGTCTTATTTCTGGCAAAAGCCGTATTGCTTCTCCATTAACCTGGATGGTTACCTATTAGTATA
TCGAAGTCTATGCTAGCCTCTAGGTTCTCTCAGCCCATACTCACAAGTTCCTGTTAGAGTGGTCTTGGCTGACACACCCC
TTCCCCTGCCCTAAACCTCTCGTCTCCAGCTCCCGAGATTCGCTTCACTTCCCTCANCTTCTCTTTCCTATGTAAGTCAN
CCATTTCGATTATGCGTTATGTATGCAGTCTCCTGGTGGGTCNNTNTNTCTCTCTCTCTNTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI22412

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8913764..8914071 294
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023156 (Rpp14) NM_025938 ribonuclease P 14 subunit (human) Gene [Source:MGI Symbol;Acc:MGI:1914303]

 
Come back to gene ENSMUSG00000023156


For any suggestions or comments, please send an email to unitrap@crg.es