Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15000A10
Clone ID IST15000A10
Vector VICTR78
Project tigm

Sequence tag IST15000A10HMF1
Sequence
AAACGGAATAAAAATCTCTAACTGCCTTCATGTAAGAGCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI22235

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 21517560..21517602 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039357 (Fut11) NM_028428 fucosyltransferase 11 Gene [Source:MGI Symbol;Acc:MGI:1920318]


Sequence tag IST15000A10HMR1
Sequence
GTTTNATGAAGATCTCATGTACATAATCCCAAAATTTCCTCTGCTGTGTCTCATTGTTGTGGATCATGGCAGTGAGAGCT
TCCCCCTGATAGAGACCTTGCCAATAATCTTGTAGCCACATTTCCTTCCAGCTGAAATGACAAAACAGGAGGGGAGGCTG
AGTTGGGGAGCCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 21517391..21517563 171
 
EST/CDNA Est Name
  CR518760.1 - BU755074.1


Sequence tag IST15000A10BBF1
Sequence
AAACGGAATAAAAATCTCTAACTGCCTTCATGTAAGAGCTGTTAACTTGGAAGACTGCGTTACTGTGGTACCTGAGGCAC
ATCCACCTTTAGTGAATACTCTATGATTGATGTTTTCACTGATTCTCTTGCCCTGTATTGGGAATTGGAACCTTGGGTTC
TGATAATACCAGGCAAGTACCCCTAGGCCCTCTCCACCTGAATGGTATGGAGCTAGTATCTCAGCCTGTGGTAAGATAGC
TTCTCCTTAAAGAGAAGCAGAAGCCAGAAGCACCCATTTGATGACTCAAGTACACTTCTCATGTCTGTAGTCATTTCATC
ATTTTAAATATGGACAGGATGGTTCAGGCTATGATCTATAAAACTTCCGTAATTTAGTACCTTTAAATANTGTCCATTCC
TCCTCTTATCAGCCGGCACACTGGTTGGGAGGCAAAGCCTTATGTGTGGGTGTGTNGTTNNGTTC
Sequence Type genomic DNA
Unitrap ID UNI22235

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 21517560..21518023 456
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039357 (Fut11) NM_028428 fucosyltransferase 11 Gene [Source:MGI Symbol;Acc:MGI:1920318]

 
Come back to gene ENSMUSG00000039357


For any suggestions or comments, please send an email to unitrap@crg.es