Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST7173-NR
Clone ID PST7173-NR
Vector U3NeoSV1
Project escells

Sequence tag PST7173-NR
Sequence
CATATTAAAAGAAAATAAAAGTAAAGCTAACTGATGGCTGGAAAAAGATTGTGCCGTTGAGATAGTCACATGAGAGTTTG
TAGCTAGTGCATTCATTCATGCATTCATTCATTCCATTTTAAACAACANTTCCCGCACGGCA
Sequence Type genomic DNA
Unitrap ID UNI15421

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 48993202..48993327 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064061 (Dzip3) NM_027341 DAZ interacting protein 3, zinc finger Gene [Source:MGI (curated);Acc:Dzip3-001]

 
Come back to gene ENSMUSG00000064061


For any suggestions or comments, please send an email to unitrap@crg.es