Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13660D5
Clone ID IST13660D5
Vector VICTR74
Project tigm

Sequence tag IST13660D5HMR1
Sequence
ACCCAAGTGATCCTTTGCCTTCCACGGGTGCCAGCACACCCACAACCACACCCACAAGAAATAAATACAGCCGGGCGTGG
TGGCGCACGCCTTTAATCCCAGCATTCAGGAGGCAGAGGCAGGAGGATTTCTGAGTTTGAGGCCAGCCTGGTCTACAGAG
TGAGTTCCAGGACAGCCAGGGCTACAGAGAAACCCTGTCTCGGAAAACCAAAAAAAAAAAAAAAAAAAAAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168520738..168520969 228
 
EST/CDNA Est Name
  CD354835.1


Sequence tag IST13660D5HMF1
Sequence
GGGTGAGTTCTCATCTTTCCATGTGGGTCCTGGGGAATCCCCCCAGCACTGTAGCTTCTCTCANAAGCCAG
Sequence Type genomic DNA
Unitrap ID UNI30596

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168520672..168520741 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027546 (Atp9a) NM_015731 ATPase, class II, type 9A Gene [Source:MGI (curated);Acc:Atp9a-003]

 
Come back to gene ENSMUSG00000027546


For any suggestions or comments, please send an email to unitrap@crg.es