Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11680H4
Clone ID IST11680H4
Vector VICTR76
Project tigm

Sequence tag IST11680H4BBF1
Sequence
AGAGGACCTGGTTTTAATTCCTAGTACCCACCTGATGACTCACAGCTGTCCTGTCACTTACTCTAATCCCAGGAAATGCA
CAAAGACAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI35187

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 69714105..69714197 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051730 (Mettl5) NM_029280 methyltransferase like 5 Gene [Source:MGI (curated);Acc:Mettl5-001]

 
Come back to gene ENSMUSG00000051730


For any suggestions or comments, please send an email to unitrap@crg.es